First Report of <i>Fusarium equiseti</i> Causing Wilt of <i>Cajanus scarabaeoides</i>, a Wild Relative of Pigeonpea, in India

HomePlant DiseaseVol. 105, No. 9First Report of Fusarium equiseti Causing Wilt Cajanus scarabaeoides, a Wild Relative Pigeonpea, in India PreviousNext DISEASE NOTE OPENOpen Access licenseFirst IndiaRaj K. Mishra, Monika Abhishek Bohra, Satheesh Naik SJ, P. R. Saabale, Krishna Kumar, Prakash G. Patil, D. Srivastava, and N. SinghRaj Mishra†Corresponding author: Raj Mishra; E-mail Address: [email protected]://orcid.org/0000-0003-0270-7424ICAR-Indian Institute Pulses Research, Kanpur, IndiaSearch for more papers by this author, MishraICAR-Indian BohraICAR-Indian SJICAR-Indian SaabaleICAR-Indian KumarICAR-Indian PatilICAR-Indian SrivastavaCouncil Science Technology, Lucknow, Uttar Pradesh, SinghICAR-Indian author AffiliationsAuthors Affiliations Mishra1 † Bohra1 SJ1 Saabale1 Kumar1 Patil1 Srivastava2 Singh1 1ICAR-Indian 2Council Published Online:27 Sep 2021https://doi.org/10.1094/PDIS-12-20-2723-PDNAboutSectionsView articlePDFPDF PlusSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleWild species or crop wild relatives provide an opportunity introduce novel traits expand the genetic base cultivated pigeonpea (Bohra et al. 2020). Among its relatives, scarabaeoides is cross-compatible with (C. cajan). To identify resistant sources use breeding, study was conducted using 79 accessions at ICAR-Indian India, 2016–17 2017–18. The belonged Cajanus, Rhynchosia, Flemingia. During field scouting, seedlings were observed foliar chlorosis wilting. Infected stem tissue exhibited brown black discoloration, followed gradual plant drying, ultimately death. plants collected, pathological examination performed. Wilted parts surface disinfected 1% NaOCl 2 min, 5.0-mm pieces transferred Petri dishes containing 90 mm specific medium (FSM) (Nash Snyder 1962) incubated 27°C. After 48 h incubation, white orange aerial mycelial growth observed. fungus fresh FSM purified single-spore technique (Choi 1999). Macroconidia had four six septa, slightly curved apex, 20.0 25.0 × 3.0 5.5 ?m. Microconidia absent. isolated putatively identified as belonging complex based on colony morphology macroconidia characteristics (Leslie Summerell 2006). A pathogenicity test 15-day-old healthy root dip inoculation soil (Haware Nene 1994). Plant roots immersed 6 106 conidia/ml suspension 3 4 min (Marley Hillocks 1996); control sterilized distilled water. culture F. grown PDA-containing dishes. Two actively mycelia discs (5 diameter) from periphery 7-day-old pure separately inoculated 500-ml conical flasks 100 g meal medium. 28 ± 2°C 10 days. fungus/soil mixture prepared mixing 200 inocula kg autoclaved sand/soil (3:7). Earthen pots (15-cm formalin (0.1%). Pots then filled mixture. Seeds HgCl2 (1%) sown each pot. uninoculated served control. Five seeds pot three replications. Disease symptoms developed days after greenhouse. Symptoms identical those field. No Reisolating pathogen corroborated Koch’s postulates. Reference cultures isolates deposited Indian Type Culture Collection, Agricultural Research Institute, New Delhi, under ITCC8413, ITCC8414, ITCC8415. Fungal genomic DNA extracted through modified CTAB method (Murray Thompson 1980). ITS regions 1 2, including 5.8S rDNA region, part translation elongation factor 1-? (TEF) amplified ITS6F ITS4R tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis sequences generated showed 98.78% homology equiseti. GenBank (ITS: MF351849, MF351850, MF351851; TEF: MK259963, MK264345, MK264346). Phylogenetic TEF revealed that all belong other available spp. Occurrence various reported worldwide (Liang 2011; Prasad 2017; Ramchandra Bhatt 2012). This first report wilt disease caused (Corda) Sacc.The author(s) declare no conflict interest.References:Bohra, A., 2020. Theor. Appl. Genet. 133:1721. https://doi.org/10.1007/s00122-020-03563-7 Crossref, ISI, Google ScholarChoi, Y. W., 1999. Divers. 3:29. ScholarHaware, M. P., Nene, L. 1994. Phytopathol. 47:400. ScholarLeslie, J. F., Summerell, B. A. 2006. Laboratory Manual. Blackwell Publishing, Ames, IA. https://doi.org/10.1002/9780470278376 ScholarLiang, L., 2011. Can. Pathol. 39:77. ScholarMarley, S., Hillocks, 1996. Field Crops Res. 46:15. https://doi.org/10.1016/0378-4290(95)00083-6 ScholarMurray, G., Thompson, W. 1980. Nucleic Acids 8:4321. https://doi.org/10.1093/nar/8.19.4321 ScholarNash, S. M., Snyder, C. 1962. Phytopathology 52:567. ScholarPrasad, 2017. 99:799. ScholarRamchandra, Bhatt, 2012. Dis. 96:1821. https://doi.org/10.1094/PDIS-03-12-0236-PDN Link, ScholarCurrent address Patil: ICAR-National Centre Pomegranate, Solapur, India.The interest.Funding: authors acknowledge support Council (ICAR), India.DetailsFiguresLiterature CitedRelated Vol. 9 September 2021SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionKadsura coccinea showing leaf spot Botryosphaeria dothidea (D. Su al.). Photo credit: Su. Leaf Ramularia coleosporii Perilla (M. Aktaruzzaman Kim. Injection maize classification standard stalk rot (W. Jiang Li. Metrics Downloaded 494 times Article History Issue Date: 8 Dec 2021Published: 27 2021First Look: 24 Mar 2021Accepted: 17 2021 Page: 2735 Information© American Phytopathological SocietyFundingIndian ResearchCouncil TechnologyKeywordswild pigeonpeaCajanus scarabaeoideswiltdiseaseFusarium equisetiIndiaThe interest.PDF download